keionnajohnson321 keionnajohnson321

15-11-2022
Social Studies

contestada

Question
Anti-semitism can be defined as the hatred or discrimination of someone because that person is
Responses
A Jewish.Jewish.
B Christian.Christian.
C Arab.Arab.
D Catholic.

Respuesta :

Otras preguntas

Which type of burn is BEST described in the image below? 2082-01-05-01-00_files/i0290000.jpg A. first-degree burn B. second-degree burn C. thir

There is no vegetation present within the alpine biome.

What happens in the G2 phase of the cell cycle? The cell prepares for cell division. The replicated chromosomes divide. The cell enters the post mitotic phase.

the period of a sound 440-Hertz sound wave is how many second/second.

Please help I really need to pass my English online

Which events occurred in 1943 and helped to make the Allied victory possible? A. Hitler violates the Nazi-Soviet Pact by invading the Soviet Union. B. The Allie

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

What is the solution to the system of equations below? y= -6x-10 and y= 1/2x-21

explain what is meant by the phrase servant of the people

BRAINLIEST!!!! Question 20 Unsaved Brenda lives 4 miles due south of the pool, and Michelle lives 3 miles due east of the pool. What is the straight line dist