Osvaldo3865 Osvaldo3865

12-04-2024
Mathematics

contestada

Suppose there is data on the number of scratches on various widgets. Based on this information, which distribution is likely the best fit for this data?
A. Hypoallergenic
B. Gaussian
C. Normal
D. Poisson

Respuesta :

Otras preguntas

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

can i have some help :

What are ya'll hoping to get for Christmas? Tell me in the comments below!

Share 120 in the ratio 3:5:7

how many grams are in 1.35 moles of NH3

2. Scholarships The probability that Samantha will be accepted by the college of her choice and obtain a scholarship is 0.35. if the probability that she is acc

what's the points distance I need help!

What will happen if the two plungers are pressed together firmly? Explain your answer.

Write all the terms of the following X+y+z

5. The combined perimeter of a circle and a square is 16. Find the dimensions of the circle and square that produce a minimum total area.