lozanovalentin15 lozanovalentin15

15-11-2018
English

contestada

What type of tone would be inappropriate in a document explaining how to perform brain surgery

Respuesta :

adamjsicola02 adamjsicola02

15-11-2018

humorous probably, because, its brain surgery.

Answer Link

Otras preguntas

What is the answer???

Cohort studies preserve the temporality of cause (exposure) happening before the effect (disease) a. True b. False

Point) a norman window has the shape of a rectangle with a semi circle on top; diameter of the semicircle exactly matches the width of the rectangle. find the d

Are primitive traits typical of broader or smaller clades?

which pattern of evolution results in one species splitting into many over time ? A) coevolution B) divergent evolution C) convergent evolution D) sexual selec

Mr.Roney bought a brand new car for $25,000 in 2015. It is projected that her car will lose value by 7.25% each year. If Mr.Roney decides to sell his car in 202

Eduardo has 27 cubic feet of wood chips to use for a new path in a garden. The chips must be 6 inches deep, and the path is 3 feet wide. How long can a path be?

which which army General was given command of US troops during war war

The human disease filariasis is caused by worms from which phylum? nematoda platyhelminthes annelida cnidaria mollusca

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg