16379549 16379549

12-02-2019
Mathematics

contestada

for which equation is y=7 a solution

A 7y=1
B 18=11+y
C y+7=0
D y/2=14

Respuesta :

jaeleebell jaeleebell

12-02-2019

The answer is b 18=11+y

Answer Link

MicaiahWilsonpa MicaiahWilsonpa

12-02-2019

Answer:

The answer is B:18=11+y

Step-by-step explanation:

Answer Link

Otras preguntas

why are most laws written

Shelby graphs the function f(x)=(x-3)2 -1. Which statements are true about the graph? Check all that apply

Can someone explain how to do number 3 please?! The answer is 1 over 32

Which phrase from the paragraph best helps the reader understand the meaning of the underlined word? Kate wanted to remove some tarnish from some old silverwar

Caleb purchases 5 beach towels for d dollars each. Each towel is charged an additional 6% sales tax. Which expressions can Caleb use to find the total cost of

Escoge el mandato formal escrito correctamente. No hagas eso. No cruce la calle. Ponte una chaqueta.

In January, Earth is closest to the Sun in its orbit. Yet the Northern Hemisphere experiences winter. Which statement explains this phenomenon?

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

The distribution of particles from an area of higher concentration to an area of lower concentration is called

Which two pairs of words from these lines create the paradox