sabrinaandmom2016 sabrinaandmom2016

13-04-2019
Mathematics

contestada

Elma has $45. She gives 2/5 of her money to her sister. How much money did she give her sister?

Respuesta :

13-04-2019

Answer:

$18

Problem solving process：45*2/5=90/5=18

Answer Link

Аноним Аноним

13-04-2019

Answer:

$18

Step-by-step explanation:

45 ÷ 5 (denominator)=9 9x2(numerator)=18

Answer Link

Otras preguntas

From 2001–2009, ______ prosecutions involved weapons of mass destruction

Sulfuric acid (h2so4) is spilled on a laboratory bench. which chemical would be useful for neutralizing the acid

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

A red die is tossed and then a green die is tossed. What is the possibility that the red die shows a six or the green die shows a six?

Steve is turning half of his backyard into a chicken pen. His backyard is a 24 meter by 45 meter rectangle. He wants to put a chicken wire fence that stretches

I need help with this!!!!!

:) Question is attached

The essential documents of the american founding are the ________ and the ________.

How do the nervous system and endocrine system differ in regards to managing homeostasis?

The respiratorry disease is one in which air cannot move in and out of alveoli