sophiafriend34 sophiafriend34

15-05-2020
Biology

contestada

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74 queenb74

15-05-2020

The answer is DNA I know because I know

Answer Link

savitar0291 savitar0291

15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

What is the correct meaning of the word novelty?

Use the Babylonian method to estimate the square root of 107 to the nearest tenth. 10.2 10.3 10.5 10.4

Benjamin threw a rock straight up from a cliff that was 36 ft above the water. if the height of the rock h, in feet, after t seconds is given by the equation

How did uneven distribution of wealth contribute to unrest in Latin American countries?

Read the excerpt below and answer the question. “HEDDA: It gives me a sense of freedom to know that a deed of deliberate courage is still possible in this world

PLEASE SOMEONE HELP ASAP

Which entrepreneur created TOMS shoes, a company that donates a pair of shoes to a child in need for every pair purchased?

How many different arrangements of the letters in the word PARALLEL are there? 563,36040,320

Find the area of the triangle that has a base of 5 in. and a height of 3 3/4in

Write the first six terms of the arithmetic sequence with the given first term, a 1, and common difference, d.