helenirby1964 helenirby1964

22-05-2020
Chemistry

contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof

22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

Which statement is true? Lipids are a type of fat. Fats are a type of lipid. Fats and lipids are separate and unrelated substances. All lipids are fats, and all

What is the Galaxy we live in called?

how to convert 37 \ 4 to a mixed number

Explain how diabetes can affect two other human body systems.

Can you please help with the question c) I don't get it. The numerators are an arithmetic sequence with a common difference and the denominators are the geomet

what does the suez canal allow

seven cakes cost £2.10 how much do ten cakes cost

Consider the following system of equations. y = 6x - 6 y - 6x = 5 What can you conclude about the system of equations?

In which situation is the object experiencing balanced forces? A) A girl swings on a swing at the playground. B) A car brakes as it approaches a traffic light.

if you wanted to learn more about the genetic material of plant and animal cells, were would you look ? a. in the lysosomes b. in the nucleus c. inside the chlo