chadortdolma chadortdolma

12-07-2020
Chemistry

contestada

How many moles of Boron are present in 20g of borax (sodium tetraborate)?

Respuesta :

Аноним Аноним

12-07-2020

20 grams of borax contains (20.0g) / (201 g mol -1) =0.10 mol of borax.

Therefore 0.40 mol of borax

Answer Link

Otras preguntas

Malcolm, aged 35, is severely depressed. because of this, he is given electroconvulsive therapy. after treatment, he is sent home and does much better. however,

Which triangle is similar to JKL? A.) JKM B.) MKL C.) KML D.) LJK

How was the country of Turkey created? The United Nations granted Turkey a mandate to govern former Ottoman lands. Mustafa Kemal won Turkish independence from

Choose the correct classification of 2x4 − 8x5 − 2x2 + 5.

what is the value of x? |x|=16

_________ eruptions are common first phases in the eruptions of volcanoes as they "clear their throats" before emitting larger eruptions.

How can the law of comparative advantage be applied to Country A and Country B? Both countries should produce petroleum and seafood. Both countries should prod

Plz help me with this question plz......... I really need help it's due tomorow

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

what is the name of the first president?