Glenahue6yaus8ty Glenahue6yaus8ty

14-09-2016
History

contestada

Who deposit money under privacy rule not disbursed to complainant

Respuesta :

WorldlyGlass49 WorldlyGlass49

14-09-2016

The entity that deposits money under privacy rule and is not disbursed to complainant is the US Treasury.

Answer Link

Otras preguntas

Write a mathematical expression for the following statement Four times x is more than 13

A={a,b,c,d,e,f,g} alt kümeleri acillllll

(1) The climate becomes colder when the amount of dust at high altitudes in the atmosphere Increases. (2) There are several ways that dust may get into the atmo

Which statement is true? (select one). Gaining ethical approval means that ethical issues will not arise in your research. Research ethics is about ensuring tha

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

can somebody please help me with this question

Please compare the attitude toward property of Aristotle, Marx, Plato with that of Rousseau’s Social Contract and Discourse on Inequality.

1. What is one type of language created by two different parties?2. By 2200 what will occur with languages ( and what is one cause of it )?

Which property should I use(Rational numbers) & how to solve

Free verse merchant of Venice act 4 summary