sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

one effect of uncontrolled diabetes is that the blood might develop an acidic ph. As a result, cells may not be able to regulate their internal pH. Within these

Identify the correct sentence. a. Drive South on Park road until you reach Euclid avenue. b. Drive south on Park Road until you reach Euclid Avenue. c. Drive

Why can't there be a number lower than absolute zero

Why was John Jay criticized when he came back from England?

a person who agreed with Hamilton's viewpoint in a quote would say

The sum of two numbers is 27 . One number is 2 times as large as the other. What are the numbers?

Multi-step: A perfect score on a test with 25 questions is 100. Each question is worth the same number of points. a. How many points is each question on the tes

what prefix would you add to lysis to mean separate or split using water?

Frederick Lugard justifies Britain's actions of imperialism by saying that?

The sum of two numbers is 27 . One number is 2 times as large as the other. What are the numbers?