i1nizam1i i1nizam1i

13-10-2020
Biology

contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA

What is the corresponding RNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the corresponding RNA sequence for the DNA strand above class=

Respuesta :

13-10-2020

Answer:

Changing G to C

C to G

A to U

and T to A, the answer will be C

Answer Link

Otras preguntas

Please help! I think its A but I'm not sure thanks

In the _________, if profits are not possible, the perfectly competitive firm will seek out the quantity of output where _____________________ .

What is the total amount in an account that has had $35 per month added into it for 30 years and grew with an annual interest rate of 7%?

The mean life of pairs of shoes is 40 months with a standard deviation of 8 months. if the life of the shoes is normally distributed, how many pairs of shoes ou

In which region of the world are hominids believed to have originated?

Given that the two triangles are similar, solve for x if AU = 20x + 108, UB = 273, BC = 703, UV = 444, AV = 372 and AC = 589.

How do fossil fuels form? a.decomposers remove fossil fuels from dead plants. b.bacteria fix carbon into fossil fuels. c.plants release fossil fuels in photosyn

Which type of human body cell would you except to have the most amount of folding in the mitochondria? A. Appendix B. Liver C. Heart D. Skin

I NEED HELP PLEASEEEEEE I WILL RATE BRAINLIEST!!!! How many moles of O2 were produced in a decomposition reaction of H2O2 if the barometric pressure was 0.980

Factor the following.