ricorico01 ricorico01

11-11-2020
Biology

contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong

19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

Simplify using order of operations: 2(5 – 8) x 42.

According to social theorist randall collins, getting a "piece of paper" is more important to many than actually having the knowledge to do a job. he calls the

Who created the daisy girl commercial

If the sales tax in Maple Town is 9.5%, how much would an ice cream of $4.25 cost with the tax added? Please explain.

At a country concert, the ratio of the number of boys to girls is 2:7. If there are 250 more girls than boys, how many boys are at the concert? PLZ HELP

what is the irony of himmel street? describw himmel street in your answer? - the book thief

How was the statue of liberty was a representative value of either the gilded age or the ashcan school artists?

Sugar dissolves readily in water because it is a(n) ____ substance

How many calories are provided by a food that contains 20 grams of carbohydrate, 8 grams protein, and 5 grams of fat? a. 232 b. 378 c. 157 d. 258 e. 558?

Which correctly applies the distributive property to show an equivalent expression to (–2.1)(3.4)?