SlmallmayShKaitlin SlmallmayShKaitlin

15-10-2016
Arts

contestada

How did raphael's portraits differ from da vinci's portraits?

Respuesta :

15-10-2016

raphael used very plain backgrounds for his portraits to focus on the main subject, whereas da vinci added some extra detail

Answer Link

08-01-2021

Answer:

Raphael used plain backgrounds to focus attention

Answer Link

Otras preguntas

What is the complementary strand of DNA to the one below? AAACCGTATCCGCGGTATATCGCCGGAAT

If you help I'll mark as brilliant!!!

Refer to the Newsela article "A Critical History of 'Lord of the Flies.'" Which sentence from the article best supports its author's assertion that Golding's no

DO NOT WASTE MY POINTS! PLZ HELP! The first options are A.pillars B.Domes The second one is A.Pillars B. Minaret

Seating 7 students in a row in a classroom

The jackets price was 76€ It was sold on sale with 15% discount. Count the discount and discounted price

Find the value of x

A closed pipe creates a fifth harmonic frequency of 125 Hz. What is the next lower frequency that will create a standing wave in the pipe? (Speed of sound = 343

If you help I'll mark as brilliant!!!

Which statement represents a central idea of the story, "The Bane of the Internet"? Hard work does not ensure success. The American dream is a cruel hoax. Physi