aj4ulichalessickson aj4ulichalessickson

21-10-2016
English

contestada

What the sentence error is in this sentence? The food here is so tasty that none of the restaurants had matched up to it.

Respuesta :

Greenleafable Greenleafable

01-11-2016

The error is that the verb had matched is in the wrong verb form. The correct way to say it would be "The food here is so tasty that none of the restaurants matches up to it". Then it would be grammatically correct.

Answer Link

Otras preguntas

what is the area of the polygon with explanation

use factoring to solve quadratic equation. Check by substitution or by a graphing utility.4x^2=19x+30

why do people keep leaving me on read and how to stop being sad about it?

A regular ice cream cone is 5 inches tall and has a diameter of 2.5 inches. A waffle cone is 7 inches tall and has a diameter of 3.75 inches. (a) Find the volum

When countries such as China emerge from communism, they often require foreign investments. Why?

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

reduce 105 in the ratio 3:5

I need help ASAP it for my English class

Find the sum of the first six terms of the geometric sequence. an = 8(3)n-1 2,952 8,

how is literacy rate calculated