fahhxtgo5men6it fahhxtgo5men6it
  • 21-10-2016
  • Chemistry
contestada

Radio waves have
a. low frequency and long wavelength
b. low frequency and short wavelength
c. high frequency and long wavelength
d. high frequency and short wavelength

Respuesta :

SJ2006
SJ2006 SJ2006
  • 29-10-2016
A.) Low frequency and Long Wavelength
Answer Link

Otras preguntas

A rectangular loop of wire that can rotate about an axis through its center is placed between the poles of a magnet in a magnetic field with a strength of 0.40
What should an expository thesis statement do?
Please help I don’t understand
How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG
true or false the whig party selected millard fillmore as a presidential candidate in 1849
For high school seniors, coronavirus brings a sad ending and unexpected lessons
Need help to solve this equation
She saw a book for her child. Function of FOR HER CHILD?
Three identical bottles of soda are used in an experiment. One of the bottles is left at room temperature, another is cooled, and another is heated. Next, the b
Does anyone know what I’m doing wrong here?