agyeiwaavanessa5
agyeiwaavanessa5 agyeiwaavanessa5
  • 10-01-2021
  • Mathematics
contestada

Express 4037 in standard form​

Respuesta :

mumsy
mumsy mumsy
  • 10-01-2021

Answer:

Step-by-step explanation:

4037 in standard form

4037=4.037*10^3

Answer Link

Otras preguntas

Given h(x)=-3x-4h(x)=−3x−4, find h(0)
Activity log- moving in a straight line Pls help 15 points
what are some monumental famous things in NYC?​
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
Given f(x) = -x+ 6 and g(x) = f(x + 3), write an equation for function g. plz help
The points (4, 10) and (1,4) fall on a particular line. What is its equation in slope-intercept form?
amelia sells jewelry. she earns 12% commission on her sales , and a weekly salary of 550. how much did amelia earn this month if she sold 22,540 worth of jewelr
Give three clues that indicate that the poet is taking a humorous tone in this poem. “Macavity the Mystery Cat” – by T.S. Eliot Macavity's a Mystery Cat: he's
Not sure how this works as a fraction to place the dot in the right place
Tryouts Kayla tried to ignore her sore throat and stuffy nose. She was trying out for the soccer team, and Coach Markham would pick only the twenty best players