Seudónimo Seudónimo
  • 13-01-2021
  • Arts
contestada

what does polymorous mean pls explain

Respuesta :

2304007
2304007 2304007
  • 13-01-2021

Poly is when you're in a relationship with multiple people, and everyone in the group consents to it. They all need to be aware though in order for it to be considered poly.

Answer Link

Otras preguntas

How many screeches are equal to 20 meows? 20 meows = 12 laughs 3 laughs = 2 purrs 40 purrs = 120 screeches Explain how you got there.
Write the converse of the following statement. Then determine its validity. a. If the diagonals of a parallelogram are congruent, then the parallelogram is a r
Find a counterexample for this statement. A quadrilateral has four congruent sides.
I buy a newspaper (Simple future)
please help me, and be nice, don't be a jer.k (you know who you are..) ty :)
is the pair of complementary angles are in the ratio4:11 find them​
How do people usually help each other?
With what emotion does Brian struggle most in this chapter? self-pity loneliness fear impatience
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
What business did the Medici’s run in the 15th century ?