madisoncorbett293 madisoncorbett293

15-01-2021
Mathematics

contestada

517 37/50 + 312 3/100

Respuesta :

papismurfisbae papismurfisbae

15-01-2021

Answer:

Exact form: 32977/100

Decimal form: 829.77

Mixed number form: 829 77/100

Step-by-step explanation:

Answer Link

Otras preguntas

1. The square root of 70 is between what two numbers? A) 7 and 8 B) 8 and 9 C) 9 and 10 D) 64 and 81 2. Which of the choices is NOT a good example of a line

Help ASAP worth 10 points

The amount of money it takes to fill up a gas tank varies directly with the number of gallons bought. It cost $21.87 to fill up a car with gasoline with 9 gallo

In a(n) _____, the company stops the disputed behavior but does not admit that it broke the law.

After you group related information into sections, you should use a clear statement from each section to A. formulate your thesis statement. B. create a str

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

How is a line of credit similar to a credit card? A. Interest is charged only on the amount you actually borrow. B. The interest rates are the same. C. They bot

Which of the following lines is perpendicular to y=-2x+3?

Which is a urine test that measures glucose, ketones, and other substances in the urine?

I really need help on #51