davilaodalis79 davilaodalis79

12-02-2021
Spanish

contestada

The Mayans developed the most sophisticated writing system in the Pre-Columbian Americas.
A) true
b) false

Respuesta :

mayabrodsgaard mayabrodsgaard

12-02-2021

Answer: true.

Explanation: im sorry, if im wrong, i hoped i helped!

Answer Link

Otras preguntas

Isaiah is on an insurance plan provided through his father's employer. He had oral surgery that was supposed to be billed to his dental insurance, but they are

The ear captures sound waves and the brain interprets them as sounds. a. True b. False

Funds allocated to parents that they may use to purchase education for their children from public or private schools in the area are

The data from studies of the biological and adoptive parents of children who receive a diagnosis of schizophrenia as adults show that the concordance rate of sc

185g shared to the ratio of 2:3

What is one unexpected problem associated with cell phone use? A. It decreases the efficacy of your peripheral vision. B. It distracts your hearing from events

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

WILL GIVE BRAINLIEST HELP PLEASE

Wich of the expressions have like terms -3m+5m 2y+4x t+7.25t 14m+mn 5xy-3xy 4-8p

The four swimmers listed in the table are trying out for the swim team. If 3 swimmers will make the team, how many combinations of 3 swimmers are possible? 3