aldaveraailin0 aldaveraailin0

15-09-2021
Chemistry

contestada

How does direct current differ from
alternating current ?

Respuesta :

starxlynn starxlynn

15-09-2021

a direct current flows in one direction and an alternating currents flow consists of electrons switching back and forth

Answer Link

Otras preguntas

Which passage most likely intends to create suspense? A. When spring comes to a small midwestern city like Waldum, a sense of celebration takes over as every

2 ^( 3 - 9) - 11 how do I solve this

what is the measure of AC?

Identify the major causes of World War II and what part the Treaty of Versailles and Europe's economic depletion after World War I played in hastening World War

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

The catalan atlas emphasized the preeminence of which western sudanic king

Which statements are true about circle Q? Check all that apply. The ratio of the measure of central angle PQR to the measure of the entire circle is 1/8 . The

mn and kl are parallel. If JM = 4, MK = 8, and LN = 10, what is NJ?

which technological advancement most strongly affected a leaders speech during kennedys time

Find the concentration of h3o+ aq in a 1.75 m solution of lactic acid, hc3h5o2 at 25 c ka= 6.4x10^-5