maddie131300 maddie131300
  • 12-11-2021
  • Chemistry
contestada

How many grams are in 0.39 moles of water

Respuesta :

chloedbonham
chloedbonham chloedbonham
  • 20-11-2021

Answer:   7.025959200000001

Explanation:

Answer Link

Otras preguntas

Which term describes the rate of energy output from a light source? A. absolute magnitude B. apparent magnitude C. luminosity D. t
a decimal that goes on forever and has a pattern of repeating digits that repeat forever
Patrick draws 2 sketches. He spends 3/7 hours drawing the first sketch. He spends 28/14 hours drawing both sketches. How much time does Patrick spend drawi
Help me Please D,B!!!!
Which of the following writing techniques are used in expository writing? analyzing defining personifying illustrating classifying foreshadowing comparing
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
Phosgene, a chemical warfare agent used in world war i, consists of 12.41% c, 16.17% o, and 71.69% cl. 1.00 l of this gas at stp has a mass of 4.42 g. what is t
Perimeter of a square that measures 5.35 cm on one side
The model commonly used by large organizations places the information security department within the __________ department.\
What if one branch were to be more powerful than the others? Give examples for every branch and what would happen.