annalynduke annalynduke

12-01-2017
History

contestada

what was required for an adult male to become a citizen of athens

Respuesta :

Аноним Аноним

12-01-2017

He would have to go in front of his "tribe" and prove or demonstrate that he was Athenian I think, hope this helps ^w^

Answer Link

Otras preguntas

What is the measure m=?

What happens when you mix lead nitrate and hydrogen peroxide?

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

11. Albert has 12 more 10 cent coins than 20-cent coins. The total value of all his coins is $5.40. Find the total number of coins he has.

2 2/3 ÷ 1 1/9 calculate the following

8. Of what importance is a smoker to a person keeping bees?

It is hard to prevent hearing damage. This is because А.the signs do not appear until it is too late. B.the sounds that cause damage are very common. C.the ear

The table below shows a portion of the planned budget for the Jones family. Their monthly income is $6,000. Budget Item Amount Retirement Savings $700 Emergency

. A certain rectangular prism is 4 inches long, 2 inches wide, and 3 inches high. Sketch the figure and find its volume.

A number has exactly 8 factors, two of which are 8 and 12.List all the factors of the number.