mariavalarezo223 mariavalarezo223

26-01-2022
Mathematics

contestada

For a certain geometric sequence, the first term is 10 and the common ratio is 3. Find the nth term in this sequence when n = 20:

Respuesta :

brucekinnu brucekinnu

26-01-2022

Yeah that’s what I did it to you after church I was going on a couple ot hours ago so I’m going down there to

Answer Link

Otras preguntas

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Receiving realistic training, understanding the types of situations encountered in war, eating well, getting enough rest, and having meaningful relationships an

Questions related to income are considered sensitive in nature. a. True b. False

Which structure is found mostly in green plants? A. Chloroplast B. Cytoplasm C. Mitochondrion D. Lysosome

Hellllllllllllllllp see picture

Which event in history is seen by many people as the beginning of the great depression in the united states? a.the stock market crash of 1929 b.the beginning of

Why do we sometimes call The European Middle Ages the dark ages

____ should only contain details that are relevant to your topic. Visual Aids Charts Models Photographs

Maggie bought 52 ounces of swordfish selling for $6.92 per pound. What was her total cost?

Peter learns the following: A cheetah travels about 0.15 kilometers in 5 seconds. A snail travels about 1.5 centimeters in 5 seconds. About how much