25roev05 25roev05

11-02-2022
Biology

contestada

What is the mRNA transcript if the complementary DNA is TCTGAG?

Respuesta :

10818570 10818570

11-02-2022

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

Answer Link

Otras preguntas

My QUESTION A car is travelling 35 miles per hour. How fast is it going when measured in meters per minute?

b. Neither Kyle nor his sister were anywhere to be found.

Speakers who speak using a monotone delivery decrease immediacy. a. False b. True

Which was a positive change that occurred in China because of Ming Dynasty policies? a. An end to taxes on peasants b.. The rise of the Tokugawa Shogunatec. Rel

agrikultura noon at ngayun

Please help me do this question

help me with this please

Find x get 15 points and brainliest 4/5x+9/10=5 1/5

This is what I need the answer for please help much appreciated if done so

Which causes a batsman to be out? 1) No ball 2) Bowled 3) Maiden over 4) Boundary