crstalbelle911 crstalbelle911

12-04-2017
History

contestada

Which sentence best describes the effect of the articles of confederation on the government

Respuesta :

1v1MeRust 1v1MeRust

14-04-2017

The Articles of Confederation made the government ineffective. This was because the central government had little to no power.

Answer Link

Otras preguntas

In "killers in our midst," what is the speaker trying to convince his audience of?

Rearrange the formula s = vt + 16t2 for v.

When a juvenile is suspected of committing a crime police have the discretion to?

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

Elements riddle: Without my next door neighbor, I wouldn’t be worth 6 cents. Who am I?

a tarin leaves little rock, Arkansas and travels north at 85 kilometers per hour. another train leaves at the same time and travels south at 70 kilometers per h

Janskssjwiwshdjdnsksj

Which two pairs of words from these lines create the paradox

Nyla writes 1/4 of a page and 1/8 of a minute. how much time does it take her to write a full page ? answer

A basketball player shoots the ball with an initial velocity of 17.1 ft/sec. at an angle of 45.6° with the horizontal. To the nearest tenth, find the initial ho