marcomartinez2420 marcomartinez2420

13-04-2020
History

contestada

What led to a catastrophic famine in Russia between 1920 and 1922?
A.A medical pandemic
B.capitalism
C. A severe drought
D. A civil war

Respuesta :

leroy7060 leroy7060

13-04-2020

Answer:

b

Explanation:

Answer Link

Otras preguntas

Write one sentence containing one positive aspect of your school

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please

Hassan’s doctor found out that, although Hassan is Rh-, he received Rh+ blood for the first time. Will he have a transfusion reaction? Explain.

In the typical English colony, voting rights were granted to A. men and women over 18 years of age B. male landowners C. white colonists D. all of the above

What is the value of b in the equation below? 9 Superscript negative 8 Baseline times 9 Superscript negative 2 Baseline = a Superscript b Negative 10 Negative

List and Paste images from newspapers and magazines in three countries (India, France, U.A.E) PLEASE SAY HOW TO DO THIS ASSIGNMENT...

what was historically significant about the 1988 election

PLEASE HURRY IM IN A RUSH!!!!!!! 100 POINTS! Which equation represents the function graphed on the coordinate plane? g(x) = |x + 1| + 3 g(x) = |x + 3| – 1 g(x

Where's the best reason why this excerpt is important to the story of the land

There are two songs on Prince’s album Sign ‘O’ the Times (1987) that feature the sound of a large choir. NAME ONE