fabian1234 fabian1234
  • 14-09-2020
  • Mathematics
contestada

4x plus 1 divided by 3 equals x minus 5 divided 2

Respuesta :

mieraanh mieraanh
  • 14-09-2020
4x+1/3 = x-5/2

2(4x+1) = 3(x-5)

8x+2 = 3x-15

8x-3x = -2-15

5x = -17

x = -17/5 (Fraction form) x = -3.4

In fraction form the answer is X equals to negative 17 divided by 5 (x = -17/5)

In decimal form the answer is X equals to negative 3 point 4 (x = -3.4)
Answer Link

Otras preguntas

Which best describes why scientists need to be creative? They need to be sure that the evidence backs up the conclusion They need to notice all of the evidence
Based on the descriptions here, what has happened to the narrator?
Which are the center and radius of the circle with this equation? x^2 - 4x + y^2 + 2y = 0
Which chemical equation is unbalanced? O C + O2 → CO2 O Sr + O2 → 2Sro 6H2 + 302 -> 6H20 O H2 + H2 + O2 → H2O + H2O
What is a hypothesis in statistics?
dean ran 5 miles this week now he want to know how many kilometers he ran
4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
Can you help me with this please??
What is the surface area of the cylinder? Express the answer in terms of Pi? Cylinder. Diameter 8 centimeters. Height 18 centimeters a 304π cm2 b 792π c
Was containment a good or bad thing during the Cold war?