aileenquintero aileenquintero

11-12-2015
Mathematics

contestada

determine if the given equations are parallel perpendicular or neither Y=7x+2 and y=7x-1

Respuesta :

11-12-2015

Equations can't be perpendicular, but the lines on their graphs can.

The graph of [ y = 7x + 2 ] has a slope of 7 .

The graph of [ y = 7x - 1 ] also has a slope of 7 .

Both graphs have the same slope. They are parallel,
not perpendicular.

Answer Link

Otras preguntas

Unit comer test just started school so idk Spanish

Which three of the following are examples of feedback mechanisms which help maintain homeostasis? A antibodies binding to a virus B flagellar rotation for cell

What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

On what two points did the Stamp Act focus?

What is genocide? How do you think genocides begin?

In the selection from Candide, what topic do Candide and Martin debate during their travels together?

The matrices show the number of indoor and outdoor volunteers in different age groups create a matrix that shows the total number of indoor and outdoor voluntee

3( x - 6) = 2x - x + 12 - 6

What do the elements within a "period" have in common? (pick one) A. same number of electrons B. similar chemical properties C. equal number of electron orbits

What is: X+2-3= When X=1